ppia cypha crispr system Search Results


90
OriGene ppia cypha crispr system
A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. <t>CRISPR/Cas9</t> knockout of <t>PPIA</t> /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .
Ppia Cypha Crispr System, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ppia cypha crispr system/product/OriGene
Average 90 stars, based on 1 article reviews
ppia cypha crispr system - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

94
Proteintech anti cypa rabbit monoclonal antibody
EBV-encoded LMP1 promotes <t>CYPA</t> expression via NF-κB activation. A The detection of CYPA protein in EBV-negative and positive 293 ​cells by Western blot assay. B The expression of CYPA in 293-LMP1 (stably expressed with LMP1) cells and EBV-negative HK-1 ​cells. C The effect of NF-κB (p65) overexpression on CYPA expression in 293 ​cells. For normal control (NC), corresponding empty vector (pCMV) was used (2 μg/well for each plasmid). D The effects of NF-κB activation and inhibition on CYPA mRNA levels evaluated by RT-qPCR in 293 ​cells. E The effect of NF-κB inhibitor (In-NF-κB) on the expression of p-p65 and CYPA in 293-LMP1 cells. For the NF-κB inhibitor in D and E , the cells were cultured in medium containing 4 ​μmol/L of inhibitor. At 24 ​h or 36 ​h post-treatment, the cell proteins and total RNA were extracted, respectively. Data were shown as mean ​± ​standard error of mean of at least three independent experiments. Statistical analysis was performed by Student's t -test. ∗∗ P ​< ​0.01, ∗∗∗ P ​< ​0.001.
Anti Cypa Rabbit Monoclonal Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti cypa rabbit monoclonal antibody/product/Proteintech
Average 94 stars, based on 1 article reviews
anti cypa rabbit monoclonal antibody - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

Image Search Results


A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. CRISPR/Cas9 knockout of PPIA /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .

Journal: bioRxiv

Article Title: A novel role for the peptidyl-prolyl cis-trans isomerase Cyclophilin A in DNA-repair following replication fork stalling via the MRE11-RAD50-NBS1 complex

doi: 10.1101/2023.06.27.546694

Figure Lengend Snippet: A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. CRISPR/Cas9 knockout of PPIA /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .

Article Snippet: The PPIA /CyPhA CRISPR system from Origene (Cat# KN203307) was used according to the manufacturer’s instructions and is composed of KN203307G1; PPIA gRNA vector 1 in pCas-Guide vector (Target Sequence: GGCAATGTCGAAGAACACGG).

Techniques: Quantitation Assay, CRISPR, Knock-Out, Stable Transfection, Variant Assay, Activity Assay, Expressing, Western Blot, Control

EBV-encoded LMP1 promotes CYPA expression via NF-κB activation. A The detection of CYPA protein in EBV-negative and positive 293 ​cells by Western blot assay. B The expression of CYPA in 293-LMP1 (stably expressed with LMP1) cells and EBV-negative HK-1 ​cells. C The effect of NF-κB (p65) overexpression on CYPA expression in 293 ​cells. For normal control (NC), corresponding empty vector (pCMV) was used (2 μg/well for each plasmid). D The effects of NF-κB activation and inhibition on CYPA mRNA levels evaluated by RT-qPCR in 293 ​cells. E The effect of NF-κB inhibitor (In-NF-κB) on the expression of p-p65 and CYPA in 293-LMP1 cells. For the NF-κB inhibitor in D and E , the cells were cultured in medium containing 4 ​μmol/L of inhibitor. At 24 ​h or 36 ​h post-treatment, the cell proteins and total RNA were extracted, respectively. Data were shown as mean ​± ​standard error of mean of at least three independent experiments. Statistical analysis was performed by Student's t -test. ∗∗ P ​< ​0.01, ∗∗∗ P ​< ​0.001.

Journal: Virologica Sinica

Article Title: Cyclophilin A binds to AKT1 and facilitates the tumorigenicity of Epstein-Barr virus by mediating the activation of AKT/mTOR/NF-κB positive feedback loop

doi: 10.1016/j.virs.2022.09.001

Figure Lengend Snippet: EBV-encoded LMP1 promotes CYPA expression via NF-κB activation. A The detection of CYPA protein in EBV-negative and positive 293 ​cells by Western blot assay. B The expression of CYPA in 293-LMP1 (stably expressed with LMP1) cells and EBV-negative HK-1 ​cells. C The effect of NF-κB (p65) overexpression on CYPA expression in 293 ​cells. For normal control (NC), corresponding empty vector (pCMV) was used (2 μg/well for each plasmid). D The effects of NF-κB activation and inhibition on CYPA mRNA levels evaluated by RT-qPCR in 293 ​cells. E The effect of NF-κB inhibitor (In-NF-κB) on the expression of p-p65 and CYPA in 293-LMP1 cells. For the NF-κB inhibitor in D and E , the cells were cultured in medium containing 4 ​μmol/L of inhibitor. At 24 ​h or 36 ​h post-treatment, the cell proteins and total RNA were extracted, respectively. Data were shown as mean ​± ​standard error of mean of at least three independent experiments. Statistical analysis was performed by Student's t -test. ∗∗ P ​< ​0.01, ∗∗∗ P ​< ​0.001.

Article Snippet: Anti-CYPA rabbit monoclonal antibody was obtained from Proteintech (Proteintech).

Techniques: Expressing, Activation Assay, Western Blot, Stable Transfection, Over Expression, Control, Plasmid Preparation, Inhibition, Quantitative RT-PCR, Cell Culture

The effect of CYPA on cell proliferation and xenografted tumor apoptosis. A The effect of CYPA knockdown by using siRNA on cell proliferation in nasopharyngeal carcinoma cell lines, HONE1 and CNE1. At 48 ​h post-transfection with siRNA, the cells were collected and Western blot assay was performed for the analysis of CYPA protein level. CCK8 assay was performed to evaluate the cell viability at indicated time point. B CYPA knockout (KOCYPA) 293 ​cell line was constructed through CRISPR/Cas9 technique. CCK8 assay was performed to evaluate the cell viability at indicated time point. C The effect of CYPA overexpression in 293 KOCYPA on cell proliferation. The Flag-CYPA plasmid (2 μg/well) were transfected into 293 KOCYPA cells, at the indicated time point post-transfection, the cells were collected and cell viability was detected by CCK8 assay. D The effect of CYPA knockout on the growth of xenografted tumor in nude mice. The 293 KOCYPA cells or 293 ​cells (2 ​× ​10 6 , 100 ​μL) were subcutaneously injected into the axillary flank of nude mice, respectively (n ​= ​3). At 45 days post-inoculation, the nude mice were sacrificed and photographed, and the tumors were then taken out and photographed. Red arrows indicate the grown tumors in mice. E Weight and volume of xenografted tumors. F IHC was performed to detect the CYPA and Ki-67 in xenograft sections. Scale bar, 100 ​μm. G Tunel staining of xenograft tumor sections. Red arrows indicate positively staining. Scale bar, 100 ​μm. H The quantitative result of G . Data were shown as mean ​± ​standard error of mean of three independent experiments. Statistical analysis was performed by Student's t -test. ∗ P ​< ​0.05, ∗∗ P ​< ​0.01, ∗∗∗ P ​< ​0.001.

Journal: Virologica Sinica

Article Title: Cyclophilin A binds to AKT1 and facilitates the tumorigenicity of Epstein-Barr virus by mediating the activation of AKT/mTOR/NF-κB positive feedback loop

doi: 10.1016/j.virs.2022.09.001

Figure Lengend Snippet: The effect of CYPA on cell proliferation and xenografted tumor apoptosis. A The effect of CYPA knockdown by using siRNA on cell proliferation in nasopharyngeal carcinoma cell lines, HONE1 and CNE1. At 48 ​h post-transfection with siRNA, the cells were collected and Western blot assay was performed for the analysis of CYPA protein level. CCK8 assay was performed to evaluate the cell viability at indicated time point. B CYPA knockout (KOCYPA) 293 ​cell line was constructed through CRISPR/Cas9 technique. CCK8 assay was performed to evaluate the cell viability at indicated time point. C The effect of CYPA overexpression in 293 KOCYPA on cell proliferation. The Flag-CYPA plasmid (2 μg/well) were transfected into 293 KOCYPA cells, at the indicated time point post-transfection, the cells were collected and cell viability was detected by CCK8 assay. D The effect of CYPA knockout on the growth of xenografted tumor in nude mice. The 293 KOCYPA cells or 293 ​cells (2 ​× ​10 6 , 100 ​μL) were subcutaneously injected into the axillary flank of nude mice, respectively (n ​= ​3). At 45 days post-inoculation, the nude mice were sacrificed and photographed, and the tumors were then taken out and photographed. Red arrows indicate the grown tumors in mice. E Weight and volume of xenografted tumors. F IHC was performed to detect the CYPA and Ki-67 in xenograft sections. Scale bar, 100 ​μm. G Tunel staining of xenograft tumor sections. Red arrows indicate positively staining. Scale bar, 100 ​μm. H The quantitative result of G . Data were shown as mean ​± ​standard error of mean of three independent experiments. Statistical analysis was performed by Student's t -test. ∗ P ​< ​0.05, ∗∗ P ​< ​0.01, ∗∗∗ P ​< ​0.001.

Article Snippet: Anti-CYPA rabbit monoclonal antibody was obtained from Proteintech (Proteintech).

Techniques: Knockdown, Transfection, Western Blot, CCK-8 Assay, Knock-Out, Construct, CRISPR, Over Expression, Plasmid Preparation, Injection, TUNEL Assay, Staining

The effect of CYPA depletion or restoration on cell apoptosis evaluated by flow cytometry (FCM) assay. A After transfected with siRNA targeting CYPA, HONE1 and CNE1 cells were collected and stained with Annexin V & PI. Cell apoptosis was evaluated by FCM. Apoptosis rate was calculated. UR, upper right, representing late apoptotic cells; LR, lower right, representing early apoptotic cells. B Effect of CYPA knockout and CYPA ectopic expression on cell apoptosis. For the CYPA overexpression, the 293 KOCYPA cells were transfected with Flag-CYPA plasmid (2 μg/well in 6-well plate). At 24 ​h post-transfection, the cells were collected and used for FCM assay. Data were shown as mean ​± ​standard error of mean of three independent experiments. Statistical analysis was performed by Student's t -test. ∗ P < 0.05, ∗∗ P ​< ​0.01.

Journal: Virologica Sinica

Article Title: Cyclophilin A binds to AKT1 and facilitates the tumorigenicity of Epstein-Barr virus by mediating the activation of AKT/mTOR/NF-κB positive feedback loop

doi: 10.1016/j.virs.2022.09.001

Figure Lengend Snippet: The effect of CYPA depletion or restoration on cell apoptosis evaluated by flow cytometry (FCM) assay. A After transfected with siRNA targeting CYPA, HONE1 and CNE1 cells were collected and stained with Annexin V & PI. Cell apoptosis was evaluated by FCM. Apoptosis rate was calculated. UR, upper right, representing late apoptotic cells; LR, lower right, representing early apoptotic cells. B Effect of CYPA knockout and CYPA ectopic expression on cell apoptosis. For the CYPA overexpression, the 293 KOCYPA cells were transfected with Flag-CYPA plasmid (2 μg/well in 6-well plate). At 24 ​h post-transfection, the cells were collected and used for FCM assay. Data were shown as mean ​± ​standard error of mean of three independent experiments. Statistical analysis was performed by Student's t -test. ∗ P < 0.05, ∗∗ P ​< ​0.01.

Article Snippet: Anti-CYPA rabbit monoclonal antibody was obtained from Proteintech (Proteintech).

Techniques: Flow Cytometry, Transfection, Staining, Knock-Out, Expressing, Over Expression, Plasmid Preparation

The interaction of CYPA and AKT1. A STRING online software predicts the potential interaction between CYPA and AKT1. B Endogenous CYPA interacts with AKT1 in nasopharyngeal carcinoma HK-1 ​cells that detected by co-IP. The anti-AKT1 antibody was used for pull-down, and CYPA was detected by Western blot (WB). C Exogenous CYPA interacts with AKT1. The 293 ​cells were transiently transfected with Flag-CYPA and/or AKT1-HA plasmids (4 μg/well of each plasmid in 100 ​mm dish). At 48 ​h post-transfection, the cells were collected and subjected to co-IP assay. The anti-Flag antibody was used for pull-down, and AKT1-HA was detected by WB. Overexpression of Flag-CYPA or AKT1-HA alone was used as a negative control for the pulldown. D Exogenous CYPA interacts with AKT1 in HK-1 ​cells. Flag-CYPA and AKT1-HA plasmids were transiently transfected into the cells (4 μg/well of each plasmid in 100 ​mm dish). At 48 ​h post-transfection, the cells were collected and subjected to co-IP. Anti-HA (AKT1) antibody was used for pull-down. IgG was used as a negative control of pull-down. E Interaction of CYPA with AKT1 in 293 ​cells in the presence or absence of LMP1. The 293 ​cells were transiently transfected with LMP1-Flag and/or AKT1-HA plasmid (4 μg/well of each plasmid in 100 ​mm dish), respectively. At 48 ​h post-transfection, the cells were collected and subjected to co-IP. Endogenous CYPA was immune-precipitated by using anti-HA antibody for the pull-down, and was then detected by WB. Overexpression of LMP1-Flag or AKT1-HA alone was used as a negative control, respectively. F The effect of LMP1 on co-localization between CYPA and AKT1 by immunofluorescence staining. For LMP1 overexpression, the LMP1-Flag plasmid (2 μg/well in 6-well plate) was transfected into 293T cells, the cells were used for IF assay at 36 ​h post-transfection. The 293T cells without LMP1 overexpression was used for the contrast (upper). Scale bar, 20 ​μm.

Journal: Virologica Sinica

Article Title: Cyclophilin A binds to AKT1 and facilitates the tumorigenicity of Epstein-Barr virus by mediating the activation of AKT/mTOR/NF-κB positive feedback loop

doi: 10.1016/j.virs.2022.09.001

Figure Lengend Snippet: The interaction of CYPA and AKT1. A STRING online software predicts the potential interaction between CYPA and AKT1. B Endogenous CYPA interacts with AKT1 in nasopharyngeal carcinoma HK-1 ​cells that detected by co-IP. The anti-AKT1 antibody was used for pull-down, and CYPA was detected by Western blot (WB). C Exogenous CYPA interacts with AKT1. The 293 ​cells were transiently transfected with Flag-CYPA and/or AKT1-HA plasmids (4 μg/well of each plasmid in 100 ​mm dish). At 48 ​h post-transfection, the cells were collected and subjected to co-IP assay. The anti-Flag antibody was used for pull-down, and AKT1-HA was detected by WB. Overexpression of Flag-CYPA or AKT1-HA alone was used as a negative control for the pulldown. D Exogenous CYPA interacts with AKT1 in HK-1 ​cells. Flag-CYPA and AKT1-HA plasmids were transiently transfected into the cells (4 μg/well of each plasmid in 100 ​mm dish). At 48 ​h post-transfection, the cells were collected and subjected to co-IP. Anti-HA (AKT1) antibody was used for pull-down. IgG was used as a negative control of pull-down. E Interaction of CYPA with AKT1 in 293 ​cells in the presence or absence of LMP1. The 293 ​cells were transiently transfected with LMP1-Flag and/or AKT1-HA plasmid (4 μg/well of each plasmid in 100 ​mm dish), respectively. At 48 ​h post-transfection, the cells were collected and subjected to co-IP. Endogenous CYPA was immune-precipitated by using anti-HA antibody for the pull-down, and was then detected by WB. Overexpression of LMP1-Flag or AKT1-HA alone was used as a negative control, respectively. F The effect of LMP1 on co-localization between CYPA and AKT1 by immunofluorescence staining. For LMP1 overexpression, the LMP1-Flag plasmid (2 μg/well in 6-well plate) was transfected into 293T cells, the cells were used for IF assay at 36 ​h post-transfection. The 293T cells without LMP1 overexpression was used for the contrast (upper). Scale bar, 20 ​μm.

Article Snippet: Anti-CYPA rabbit monoclonal antibody was obtained from Proteintech (Proteintech).

Techniques: Software, Co-Immunoprecipitation Assay, Western Blot, Transfection, Plasmid Preparation, Over Expression, Negative Control, Immunofluorescence, Staining

The effect of CYPA on the activation of the AKT/mTOR and NF-κB signalings. A Effect of knockdown by siRNA-CYPA on the protein expressions of key molecules related to AKT/mTOR and NF-κB pathways in NPC cells. The siRNA (50 ​nmol/L per well in 6-well plate) was transfected into HK-1 and C666-1 ​cells respectively. At 48 ​h post-transfection, the cells were collected and subjected to Western blot (WB) assay. B Effect of CYPA knockout on the activation of AKT/mTOR and NF-κB pathways by WB assay. C Effect of CYPA overexpression on the restoration of the signalings regulated by CYPA knockout. The cells were transfected with Flag-CYPA plasmid (2 μg/well). At 48 ​h post-transfection, the cells were collected and subjected to WB. The 293 KOCYPA cell line was used in ( B ) and ( C ).

Journal: Virologica Sinica

Article Title: Cyclophilin A binds to AKT1 and facilitates the tumorigenicity of Epstein-Barr virus by mediating the activation of AKT/mTOR/NF-κB positive feedback loop

doi: 10.1016/j.virs.2022.09.001

Figure Lengend Snippet: The effect of CYPA on the activation of the AKT/mTOR and NF-κB signalings. A Effect of knockdown by siRNA-CYPA on the protein expressions of key molecules related to AKT/mTOR and NF-κB pathways in NPC cells. The siRNA (50 ​nmol/L per well in 6-well plate) was transfected into HK-1 and C666-1 ​cells respectively. At 48 ​h post-transfection, the cells were collected and subjected to Western blot (WB) assay. B Effect of CYPA knockout on the activation of AKT/mTOR and NF-κB pathways by WB assay. C Effect of CYPA overexpression on the restoration of the signalings regulated by CYPA knockout. The cells were transfected with Flag-CYPA plasmid (2 μg/well). At 48 ​h post-transfection, the cells were collected and subjected to WB. The 293 KOCYPA cell line was used in ( B ) and ( C ).

Article Snippet: Anti-CYPA rabbit monoclonal antibody was obtained from Proteintech (Proteintech).

Techniques: Activation Assay, Knockdown, Transfection, Western Blot, Knock-Out, Over Expression, Plasmid Preparation

The effect of rapamycin on the activation of CYPA/AKT/mTOR/NF-κB signaling cascade. A, B The key molecules of the CYPA/AKT/mTOR/NF-κB signaling cascade were detected by WB assays. EBV-positive C666-1 ( A ) and C2089 ( B ) cells were treated with the mTOR inhibitor, rapamycin (20 ​μmol/L), respectively. At 48 ​h post-treatment, the cells were collected and subjected to the detection.

Journal: Virologica Sinica

Article Title: Cyclophilin A binds to AKT1 and facilitates the tumorigenicity of Epstein-Barr virus by mediating the activation of AKT/mTOR/NF-κB positive feedback loop

doi: 10.1016/j.virs.2022.09.001

Figure Lengend Snippet: The effect of rapamycin on the activation of CYPA/AKT/mTOR/NF-κB signaling cascade. A, B The key molecules of the CYPA/AKT/mTOR/NF-κB signaling cascade were detected by WB assays. EBV-positive C666-1 ( A ) and C2089 ( B ) cells were treated with the mTOR inhibitor, rapamycin (20 ​μmol/L), respectively. At 48 ​h post-treatment, the cells were collected and subjected to the detection.

Article Snippet: Anti-CYPA rabbit monoclonal antibody was obtained from Proteintech (Proteintech).

Techniques: Activation Assay

Schematic of the mechanism on the activation of AKT/mTOR/NF-κB signaling cascade mediated by EBV-LMP1 upregulated CYPA.

Journal: Virologica Sinica

Article Title: Cyclophilin A binds to AKT1 and facilitates the tumorigenicity of Epstein-Barr virus by mediating the activation of AKT/mTOR/NF-κB positive feedback loop

doi: 10.1016/j.virs.2022.09.001

Figure Lengend Snippet: Schematic of the mechanism on the activation of AKT/mTOR/NF-κB signaling cascade mediated by EBV-LMP1 upregulated CYPA.

Article Snippet: Anti-CYPA rabbit monoclonal antibody was obtained from Proteintech (Proteintech).

Techniques: Activation Assay